Confirmed ARS at X-337

ARS1011

Other names: proARS1011

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr10:336976-337225
Within convergent intergenic space between YJL053W and YJL052C-A.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -147.2 ΔG° (kcal/mol) at location 337106.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 31.4 min.
Yabuki et al. (2002) — Trep: 29.4 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-337 has unique ID: 342

Loading - Please wait...

ARS at X-337 has unique ID: 342

Studies that cloned this origin

Nieduszynski et al. (2006): Chr10:336976-337225


Studies that analyzed this origin by 2D gel

Gibson et al. (2004): Chr10:335824-338216

Hu & Aparicio (2005): Chr10:335824-338216


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:336733-337967

Xu et al. (2006): Chr10:335845-339105

Shor et al. (2009): Chr10:336300-337800 (orc2-1/wt peak ratio: 0.98)

Szilard et al. (2010): Chr10:336995-337005

Müller et al. (2010): Chr10:336350-337850 (orc1-bah-delta/wt peak ratio: 0.64)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:338258 (Trep: 31.4 min.) (Confidence: 8)

Yabuki et al. (2002): Chr10:335933 (Trep: 29.4 min.)

Alvino et al. (2007): Chr10:337400 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:337000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr10:336976-337225 (Activity detected in: ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-337 has unique ID: 342

Studies that confirmed an essential ACS element

  Xu et al. (2006):         TTTTATGTTTA                      

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTTATGTTTAGC                   
  Eaton et al. (2010):      TTTTTTTATGTTTAGCTAAGTAAAAGCAGCTTG   
ACS LOGO:   ACS_logo  

ARS at X-337 has unique ID: 342

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeGTTAATGCATAAGAAATATCTTTTTTTATGTTTAGCTAAGTAAAAGCAGCTTGGAG
S. kudriavzevii-TTAAAGTATACGATGCACCCGTA-TCACGCTTAGCT---TGAAAACGGCTTC---
S. mikataeGTTAAAAAATAGGTCACACCCTTC-----------CTGGGTAAAACCA-CATG---
S. paradoxusGGTAATGTAT-GTACATACCTCTTTTTATGTTTAGCATAATAAAAGTAGCTTAGAG
::***:**::::***:::::::*:*:***:::*:*

ARS at X-337 has unique ID: 342

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-337 has unique ID: 342

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Gibson et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Hu & Aparicio (2005): PubMed | PubMed Central | Proc. Natl. Acad. Sci. U.S.A.


Studies that confirmed an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at X-337 has unique ID: 342