Confirmed ARS at XIV-250

ARS1413

Other names: proARS1413

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr14:250259-250506
Within divergent intergenic space between YNL211C and YNL210W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -141.0 ΔG° (kcal/mol) at location 250429.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.1 min.
Yabuki et al. (2002) — Trep: 29.0 min.
Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIV-250 has unique ID: 514

Loading - Please wait...

ARS at XIV-250 has unique ID: 514

Studies that cloned this origin

Nieduszynski et al. (2006): Chr14:250259-250506


Studies that analyzed this origin by 2D gel

Friedman et al. (1996): Chr14:248811-251501

Aparicio et al. (2004): Chr14:247554-252796

Gibson et al. (2004): Chr14:247554-252796


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr14:250314-250930

Xu et al. (2006): Chr14:249305-251235

Shor et al. (2009): Chr14:250300-251000 (orc2-1/wt peak ratio: 0.22)

Szilard et al. (2010): Chr14:250395-250405

Müller et al. (2010): Chr14:250325-251075 (orc1-bah-delta/wt peak ratio: 0.23)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr14:250798 (Trep: 29.1 min.) (Confidence: 5)

Yabuki et al. (2002): Chr14:249469 (Trep: 29.0 min.)

Alvino et al. (2007): Chr14:251200 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr14:249333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr14:250259-250506 (Activity detected in: mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIV-250 has unique ID: 514

Studies that confirmed an essential ACS element

  Friedman et al. (1996):         ATTTGTATTTA                      

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       AATTTTTACGGTTTTT                   
  Xu et al. (2006):      ACAATTTGTATTTAGTTGGTGTGACCTCAAATTT  
  Eaton et al. (2010):      ACAATTTGTATTTAGTTGGTGTGACCTCAAATT   
ACS LOGO:   ACS_logo  

ARS at XIV-250 has unique ID: 514

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeATTTAGTTGGTGTGACCTCAAATTTTTACGGTTTTTTGAAAAGAACCCGTTATGAA
S. kudriavzeviiGTTTAGTTG--TTGATAGAATGTTTTTATGATCATTGAAAAAAAAAAGGTTTAGAA
S. mikataeGTTTAGTTGGGGCAACAAAAGATATATTTGTTCCTTCAAAAAGGGCGC----TTGA
S. paradoxusATATAGTTAATCTGACGTCTCATATTTTTGGTTCTGCAAAAAGTACCCGTTAGAGC
S. bayanusGTTTAGTTAGTGTAA-----------TTTGTATTTTAAGAAAATTTCGGATATGAA
*:*****:*::::*:*:*::::***:::

ARS at XIV-250 has unique ID: 514

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIV-250 has unique ID: 514

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Friedman et al. (1996): PubMed

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Gibson et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that confirmed an essential ACS element

Friedman et al. (1996): PubMed


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIV-250 has unique ID: 514