Confirmed ARS at X-228

ARS1009

Other names: proARS1009

Status: Confirmed ARS: Confirmed by ARS assay and identified by 10 genome-wide studies.

Genomic Location: Chr10:228248-228740
Within tandem intergenic space between SNR37 and YJL103C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -142.3 ΔG° (kcal/mol) at location 228728.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 25.6 min.
Yabuki et al. (2002) — Trep: 20.8 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-228 has unique ID: 338

Loading - Please wait...

ARS at X-228 has unique ID: 338

Studies that cloned this origin

Wyrick et al. (2001): Chr10:228248-228740


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:228297-228722

Xu et al. (2006): Chr10:227635-229405

Shor et al. (2009): Chr10:227900-229400 (orc2-1/wt peak ratio: 0.64)

Szilard et al. (2010): Chr10:228595-228605

Müller et al. (2010): Chr10:228425-229475 (orc1-bah-delta/wt peak ratio: 0.63)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:231255 (Trep: 25.6 min.) (Confidence: 9)

Yabuki et al. (2002): Chr10:225933 (Trep: 20.8 min.)

Alvino et al. (2007): Chr10:227780 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:227750 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr10:228248-228740 (Activity detected in: wild-type, rad9, rev3 rad30, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-228 has unique ID: 338

Studies that confirmed an essential ACS element

  Xu et al. (2006):         ATTTATATTTA                      

Studies that predicted an essential ACS element

  Eaton et al. (2010):      AATATTTATATTTATGTACAGTTTTACATTGTA   
ACS LOGO:   ACS_logo  

ARS at X-228 has unique ID: 338

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at X-228 has unique ID: 338

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-228 has unique ID: 338

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at X-228 has unique ID: 338