Confirmed ARS at VII-485

ARS719

Other names: proARS719

Status: Confirmed ARS: Confirmed by ARS assay and identified by 10 genome-wide studies.

Genomic Location: Chr7:484932-485160
Within divergent intergenic space between YGL007C-A and YGL006W-A.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -150.8 ΔG° (kcal/mol) at location 485132.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 24.7 min.
Yabuki et al. (2002) — Trep: 19.5 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-485 has unique ID: 235

Loading - Please wait...

ARS at VII-485 has unique ID: 235

Studies that cloned this origin

Nieduszynski et al. (2006): Chr7:484932-485160


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:484774-485916

Xu et al. (2006): Chr7:484165-485655

Shor et al. (2009): Chr7:484500-485700 (orc2-1/wt peak ratio: 0.71)

Szilard et al. (2010): Chr7:485095-485105

Müller et al. (2010): Chr7:484400-485900 (orc1-bah-delta/wt peak ratio: 0.77)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:488960 (Trep: 24.7 min.) (Confidence: 9)

Yabuki et al. (2002): Chr7:484647 (Trep: 19.5 min.)

Alvino et al. (2007): Chr7:487780 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr7:484500 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr7:484932-485160 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-485 has unique ID: 235

Studies that confirmed an essential ACS element

  Nieduszynski et al. (2006):       TTTATTTATGTTTTGC                   

Studies that predicted an essential ACS element

  Xu et al. (2006):      GTTTTATTTATGTTTTGCCGTAAGATCGATACTT  
  Xu et al. (2006):      CTCAAATATTTATTTTGTATTATTCATGCTTGAT  
  Eaton et al. (2010):      TTTATTTATGTTTTGCCGTAAGATCGATACTTT   
ACS LOGO:   ACS_logo  

ARS at VII-485 has unique ID: 235

Alignments from the UCSC genome browser

Confirmed ACS
S. cerevisiaeAAAAAAAGATAAAGTTGTGTTTTATTTATGTTTTGCCGTAAGATCGATACTTTTCT
S. kudriavzeviiAAGAAAGAATGATTTTATACATTGTTTATGTTTGGTTGTACTTTTTATTCCTTTTT
S. mikataeAAAAGAAAATGAATTTATATTTTGTTTGTGTTTTACATATAATTCCACACTTCGCT
S. paradoxusAAAGAGAAATGAATTCATATTTTGTTTATGTTTTGCTATAGTTTCGATACATTTCT
**:::::***:*:*::*****:*****:::::*:*::**:::*

ARS at VII-485 has unique ID: 235

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-485 has unique ID: 235

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VII-485 has unique ID: 235