Confirmed ARS at VI-199

ARS607

Other names: proARS607

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr6:199382-199493
Within tandem intergenic space between YFR022W and YFR023W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -140.2 ΔG° (kcal/mol) at location 199442.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 12.8 min.
Yabuki et al. (2002) — Trep: 20.4 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-199 has unique ID: 208

Loading - Please wait...

ARS at VI-199 has unique ID: 208

Studies that cloned this origin

Shirahige et al. (1993): Chr6:199382-199493


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:195811-202876

Szyjka et al. (2005): Chr6:196969-202450


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:199021-199861

Xu et al. (2006): Chr6:197805-200275

Shor et al. (2009): Chr6:198200-200300 (orc2-1/wt peak ratio: 0.63)

Szilard et al. (2010): Chr6:199535-199545

Müller et al. (2010): Chr6:198350-201350 (orc1-bah-delta/wt peak ratio: 0.66)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:196033 (Trep: 12.8 min.) (Confidence: 9)

Yabuki et al. (2002): Chr6:198613 (Trep: 20.4 min.)

Alvino et al. (2007): Chr6:199330 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:200000 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr6:199382-199493 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-199 has unique ID: 208

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         GTTTATATTTAG                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      CTTGTTTATATTTAGTTACGTTGGGATCAAGTTT  
  Eaton et al. (2010):      CTTGTTTATATTTAGTTACGTTGGGATCAAGTT   
ACS LOGO:   ACS_logo  

ARS at VI-199 has unique ID: 208

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-199 has unique ID: 208

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-199 has unique ID: 208

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed

Szyjka et al. (2005): PubMed | Mol. Cell


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-199 has unique ID: 208