Confirmed ARS at VI-119

ARS603.5

Other names: proARS603.5

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr6:118631-118952
Within tandem intergenic space between YFL009W and YFL008W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -145.5 ΔG° (kcal/mol) at location 118951.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 21.5 min.
Yabuki et al. (2002) — Trep: 21.9 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-119 has unique ID: 204

Loading - Please wait...

ARS at VI-119 has unique ID: 204

Studies that cloned this origin

Yamashita et al. (1997): Chr6:118631-118952


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:117097-120042

Gibson et al. (2004): Chr6:117436-120037


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:118478-119424

Xu et al. (2006): Chr6:117785-119195

Shor et al. (2009): Chr6:118000-119100 (orc2-1/wt peak ratio: 0.34)

Szilard et al. (2010): Chr6:118725-118735

Müller et al. (2010): Chr6:118025-119075 (orc1-bah-delta/wt peak ratio: 0.34)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:122427 (Trep: 21.5 min.) (Confidence: 9)

Yabuki et al. (2002): Chr6:119863 (Trep: 21.9 min.)

Alvino et al. (2007): Chr6:122670 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:118750 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr6:118631-118952 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-119 has unique ID: 204

Studies that confirmed an essential ACS element

  Yamashita et al. (1997):         TTTCCATATTTT                     

Studies that predicted an essential ACS element

  Eaton et al. (2010):      TGCTTTTATATTTTTTTAGATCATTTTCAAAAC   
ACS LOGO:   ACS_logo  

ARS at VI-119 has unique ID: 204

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-119 has unique ID: 204

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-119 has unique ID: 204

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Yamashita et al. (1997): PubMed


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed

Gibson et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that confirmed an essential ACS element

Yamashita et al. (1997): PubMed


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-119 has unique ID: 204