Confirmed ARS at IV-463

ARS416

Other names: ARS1, proARS416

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr4:462430-462700
Within tandem intergenic space between YDR007W and YDR009W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -156.9 ΔG° (kcal/mol) at location 462700.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 23.3 min.
Yabuki et al. (2002) — Trep: 21.3 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-463 has unique ID: 110

Loading - Please wait...

ARS at IV-463 has unique ID: 110

Studies that cloned this origin

Study details not curated: Chr4:462430-462700


Studies that analyzed this origin by 2D gel

Ferguson et al. (1991): Chr4:459716-464389

Aparicio et al. (2004): Chr4:459716-464384


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:462643-463475

Xu et al. (2006): Chr4:461475-464265

Shor et al. (2009): Chr4:462000-464700 (orc2-1/wt peak ratio: 0.55)

Szilard et al. (2010): Chr4:462555-462565

Müller et al. (2010): Chr4:461975-463775 (orc1-bah-delta/wt peak ratio: 0.62)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr4:464369 (Trep: 23.3 min.) (Confidence: 9)

Yabuki et al. (2002): Chr4:461541 (Trep: 21.3 min.)

Alvino et al. (2007): Chr4:460800 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:463666 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr4:462430-462700 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-463 has unique ID: 110

Studies that confirmed an essential ACS element

  Celniker et al. (1984):         ATTTTATGTTTA                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      CAGATTTTATGTTTAGATCTTTTATGCTTGCTTT  
  Eaton et al. (2010):      AGATTTTATGTTTAGATCTTTTATGCTTGCTTT   
ACS LOGO:   ACS_logo  

ARS at IV-463 has unique ID: 110

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IV-463 has unique ID: 110

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-463 has unique ID: 110

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

Ferguson et al. (1991): PubMed

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that confirmed an essential ACS element

Celniker et al. (1984): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-463 has unique ID: 110