Confirmed ARS at III-167

ARS310

Other names: proARS310

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr3:166494-167340
Within tandem intergenic space between YCR026C and YCR027C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -146.1 ΔG° (kcal/mol) at location 166804.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 24.9 min.
Yabuki et al. (2002) — Trep: 24.1 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-167 has unique ID: 78

Loading - Please wait...

ARS at III-167 has unique ID: 78

Studies that cloned this origin

Newlon et al. (1991): Chr3:166494-167340


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:166050-167084

Xu et al. (2006): Chr3:165855-167585

Szilard et al. (2010): Chr3:166745-166755

Müller et al. (2010): Chr3:166475-167075 (orc1-bah-delta/wt peak ratio: 0.64)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:174486 (Trep: 24.9 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:162863 (Trep: 24.1 min.)

Alvino et al. (2007): Chr3:163220 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:166666 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr3:166494-167340 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-167 has unique ID: 78

Studies that confirmed an essential ACS element

  Theis & Newlon (2001):         TTTTTACTTTTT                     

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATTATTTATGTTATGT                   
  Xu et al. (2006):      TTAATTATTTACATTTACGAATAAATTTGTATAT  
  Xu et al. (2006):      TAAAAATTTCATGTTTAGAATGCTCCTACATGTG  
  Xu et al. (2006):      CTTTTTTTTTACTTTTTGCTCTAAGAGTTACGAT  
  Xu et al. (2006):      ATTTATGTTATGTATATATAATCGTAACTCTTAG  
ACS LOGO:   ACS_logo  

ARS at III-167 has unique ID: 78

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTCCAGGTGATGTTTTATTCCATTATTTATGTTATGTATATATAATCGTAACTCTTA
S. kudriavzeviiCCTCAATGATTTTTTT-TCTGTTATTTACGTTGTGTAGGTAGGGTC-TGTCTTTTG
S. mikataeTCCAGACAGTCCCTCA-TCTATTATTTACGTTGTGTTTGCAAAACGGTACATCT--
S. paradoxusTCATGGTGATATTTTATTGTATTATTTATGTTATGTATTTGCAATCGTACTTCTTG
S. bayanusTCCTGATGATTTTTTTTTTAATTGTTAATGTTTTGTGTTTAAAAGCCT--CTATTG
:*::::*:::*:*::**:**:*******::::::::*:**::

ARS at III-167 has unique ID: 78

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-167 has unique ID: 78

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Newlon et al. (1991): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Theis & Newlon (2001): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-167 has unique ID: 78