Likely ARS at XVI-942

No systematic name assigned

Other names: proARS1632

Status: Likely ARS: Identified by 8 genome-wide studies.

Genomic Location: Chr16:940923-943157
Probably within tandem intergenic space between YPR201W and YPR202W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -157.6 ΔG° (kcal/mol) at location 942873.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 22.1 min.
Yabuki et al. (2002) — Trep: 26.3 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XVI-942 has unique ID: 639

Loading - Please wait...

ARS at XVI-942 has unique ID: 639

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr16:942079-943027

Xu et al. (2006): Chr16:940925-943155

Shor et al. (2009): Chr16:941400-943000 (orc2-1/wt peak ratio: 0.46)

Szilard et al. (2010): Chr16:942165-942175

Müller et al. (2010): Chr16:941300-943025 (orc1-bah-delta/wt peak ratio: 0.70)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr16:934218 (Trep: 22.1 min.) (Confidence: 9)

Yabuki et al. (2002): Chr16:937633 (Trep: 26.3 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr16:944500 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XVI-942 has unique ID: 639

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTATGTTTAGGTGATTTTGGTGGTGATTTTG  
  Eaton et al. (2010):      AATTTTTATGTTTAGGTGATTTTGGTGGTGATT   
ACS LOGO:   ACS_logo  

ARS at XVI-942 has unique ID: 639

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XVI-942 has unique ID: 639

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XVI-942 has unique ID: 639

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XVI-942 has unique ID: 639