Confirmed ARS at XV-1054

ARS1529.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr15:1053490-1053901
Within tandem intergenic space between YOR380W and YOR381W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -150.8 ΔG° (kcal/mol) at location 1053850.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 18.6 min.
Yabuki et al. (2002) — Trep: 19.8 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XV-1054 has unique ID: 585

Loading - Please wait...

ARS at XV-1054 has unique ID: 585

Studies that cloned this origin

Breier et al. (2004): Chr15:1053490-1053901


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr15:1052650-1054400

Shor et al. (2009): Chr15:1053400-1054100 (orc2-1/wt peak ratio: 0.98)

Szilard et al. (2010): Chr15:1053825-1053835

Müller et al. (2010): Chr15:1053500-1054175 (orc1-bah-delta/wt peak ratio: 0.26)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr15:1053760 (Trep: 18.6 min.) (Confidence: 9)

Yabuki et al. (2002): Chr15:1052971 (Trep: 19.8 min.)

Alvino et al. (2007): Chr15:1052300 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr15:1053000 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr15:1053490-1053901 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-1054 has unique ID: 585

Studies that confirmed an essential ACS element

  Nieduszynski et al. (2006):        TTGTTTAAATTTTGT                   

Studies that predicted an essential ACS element

  Xu et al. (2006):      TGTTTAAATTTTGTTCGGTCTCGGCTATATTTGG  
ACS LOGO:   ACS_logo  

ARS at XV-1054 has unique ID: 585

Alignments from the UCSC genome browser

Confirmed ACS
S. cerevisiaeGAATAATTTAATTAATTGTTTTGTTTAAATTTTGTTCGGTCTCGGCTATATTTGG
S. paradoxusAAATAATCCAACTATATGTTGTGTTTATATTTTGTTATGTTTCGGCTACATACGT
:******::**:**::****:******:********::**:*******:**::*:

ARS at XV-1054 has unique ID: 585

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-1054 has unique ID: 585

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Breier et al. (2004): PubMed | PubMed Central | Genome Biol.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XV-1054 has unique ID: 585