Confirmed ARS at XV-601

ARS1517

Other names: ARS1502, proARS1517

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr15:600885-600960
Within tandem intergenic space between TG(CCC)O and YOR143C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -144.2 ΔG° (kcal/mol) at location 600915.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 21.4 min.
Yabuki et al. (2002) — Trep: 27.5 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XV-601 has unique ID: 566

Loading - Please wait...

ARS at XV-601 has unique ID: 566

Studies that cloned this origin

Study details not curated: Chr15:600885-600960


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr15:600731-601381

Xu et al. (2006): Chr15:599885-601765

Shor et al. (2009): Chr15:600700-601700 (orc2-1/wt peak ratio: 0.26)

Szilard et al. (2010): Chr15:600945-600955

Müller et al. (2010): Chr15:600650-601625 (orc1-bah-delta/wt peak ratio: 0.69)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr15:600757 (Trep: 21.4 min.) (Confidence: 9)

Yabuki et al. (2002): Chr15:604721 (Trep: 27.5 min.)

Alvino et al. (2007): Chr15:601630 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr15:601666 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-601 has unique ID: 566

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Eaton et al. (2010):      TCTTTTTATGAGTTGTCACCAATTGATGAAATT   
ACS LOGO:   ACS_logo  

ARS at XV-601 has unique ID: 566

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XV-601 has unique ID: 566

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-601 has unique ID: 566

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XV-601 has unique ID: 566