Confirmed ARS at XV-490

ARS1514

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr15:489645-490129
Within convergent intergenic space between YOR087W and YOR089C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -141.9 ΔG° (kcal/mol) at location 490125.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 19.1 min.
Yabuki et al. (2002) — Trep: 23.1 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XV-490 has unique ID: 561

Loading - Please wait...

ARS at XV-490 has unique ID: 561

Studies that cloned this origin

Breier et al. (2004): Chr15:489645-490129


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr15:489175-490705

Szilard et al. (2010): Chr15:489885-489895

Müller et al. (2010): Chr15:489275-490325 (orc1-bah-delta/wt peak ratio: 0.46)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr15:495755 (Trep: 19.1 min.) (Confidence: 9)

Yabuki et al. (2002): Chr15:491721 (Trep: 23.1 min.)

Alvino et al. (2007): Chr15:495220 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr15:489645-490129 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-490 has unique ID: 561

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTGTTTTTCTTTTCTT                   
  Xu et al. (2006):      TAAGTTTATATTTTGGTCTACATGAAAACAAAAG  
ACS LOGO:   ACS_logo  

ARS at XV-490 has unique ID: 561

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTCATTTTTTACCGTAATCGTTGTTTTTCTTTTCTTCTTATAATTTGTAAATTTTT
S. mikataeTTCGTTTTTTACCGTATTCATTATTTTCTTTTTCTTCCT-----------------
S. paradoxusTTCGTTTTT-ACCGTAATCATTTTTTTTCTTTTCTTCCTTTAGTTTGTAAATTTTT
S. bayanusTTCGTTTTTTAA-GAAGTAATTTTTTTTTTCTTTTTTTT--TGTTTGTAACATTTG
********:*::*:**:******:*:**:**:*::::::::::

ARS at XV-490 has unique ID: 561

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-490 has unique ID: 561

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Breier et al. (2004): PubMed | PubMed Central | Genome Biol.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XV-490 has unique ID: 561