Confirmed ARS at XIV-170

ARS1411

Other names: proARS1411

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 9 genome-wide studies.

Genomic Location: Chr14:169566-169804
Within divergent intergenic space between YNL254C and YNL253W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -147.2 ΔG° (kcal/mol) at location 169716.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 30.4 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIV-170 has unique ID: 510

Loading - Please wait...

ARS at XIV-170 has unique ID: 510

Studies that cloned this origin

Nieduszynski et al. (2006): Chr14:169566-169804


Studies that analyzed this origin by 2D gel

Friedman et al. (1996): Chr14:168204-172042


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr14:169247-170017

Xu et al. (2006): Chr14:168995-170915

Shor et al. (2009): Chr14:169400-170200 (orc2-1/wt peak ratio: 0.23)

Szilard et al. (2010): Chr14:169825-169835

Müller et al. (2010): Chr14:169325-170225 (orc1-bah-delta/wt peak ratio: 0.74)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr14:167469 (Trep: 30.4 min.)

Alvino et al. (2007): Chr14:170140 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr14:169666 (Activity detected in: rad53)

Crabbé et al. (2010): Chr14:169566-169804 (Activity detected in: ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIV-170 has unique ID: 510

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       AATTTAACGTTTTGTT                   
  Xu et al. (2006):      TAATTTAACGTTTTGTTTCTTCCGTCATCATATC  
  Eaton et al. (2010):      TAATTTAACGTTTTGTTTCTTCCGTCATCATAT   
ACS LOGO:   ACS_logo  

ARS at XIV-170 has unique ID: 510

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeGTTTTATACAACGGTACAATAATTTAACGTTTTGTTTCTTCCGTCATCATATCCAG
S. kudriavzeviiGTTCTCTCTGCTTGAGTAGCATTCT----------TTTTTCCATTTTTTTCTCCG-
S. mikataeATTTCCCACCATTGTTAAATATTTTTACGTTTTGTTTCTTCAGGGTTTTTTTGTA-
S. paradoxusTTTTTCCACTACCGCAGAATATTTT-ACGTTTTGTCTCTTCCATTACTTTATTCTG
S. bayanusGTTCTTTTCACCTTTGTAACTATTTAACATTTTGCTTCTTCAGGCATTTTCT----
**::::::*::*:*::::::::*:***:::**

ARS at XIV-170 has unique ID: 510

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIV-170 has unique ID: 510

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Friedman et al. (1996): PubMed


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIV-170 has unique ID: 510