Confirmed ARS at II-592

ARS219

Other names: proARS219

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr2:591424-591713
Within convergent intergenic space between YBR180W and YBR181C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -154.9 ΔG° (kcal/mol) at location 591704.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 28.7 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-592 has unique ID: 49

Loading - Please wait...

ARS at II-592 has unique ID: 49

Studies that cloned this origin

Xu et al. (2006): Chr2:591424-591713


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr2:589749-590936

Xu et al. (2006): Chr2:589230-592410

Shor et al. (2009): Chr2:589700-592500 (orc2-1/wt peak ratio: 0.75)

Szilard et al. (2010): Chr2:591305-591315

Müller et al. (2010): Chr2:589850-591950 (orc1-bah-delta/wt peak ratio: 0.64)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr2:590478 (Trep: 28.7 min.)

Alvino et al. (2007): Chr2:589250 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr2:594000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr2:591424-591713 (Activity detected in: mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-592 has unique ID: 49

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ACTCATCCCAAGGACTTCAAGAAATAGAACAATG  
  Xu et al. (2006):      TATTATATTATTTAACTTTCAAGAAAATTTTCTC  
  Eaton et al. (2010):      ATAGTTTATGTTTAGCTATAAAATTTAACTTTT   
ACS LOGO:   ACS_logo  

ARS at II-592 has unique ID: 49

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at II-592 has unique ID: 49

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-592 has unique ID: 49

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at II-592 has unique ID: 49