Confirmed ARS at XII-1060

ARS1235

Other names: proARS1235

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr12:1059486-1059919
Within convergent intergenic space between YLR459W and YLR460C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -144.1 ΔG° (kcal/mol) at location 1059756.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 35.5 min.
Yabuki et al. (2002) — Trep: 28.9 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at XII-1060 has unique ID: 449

Loading - Please wait...

ARS at XII-1060 has unique ID: 449

Studies that cloned this origin

Liachko et al. (2010): Chr12:1059486-1059919


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr12:1058513-1059752

Xu et al. (2006): Chr12:1058850-1060800

Shor et al. (2009): Chr12:1059400-1060700 (orc2-1/wt peak ratio: 0.32)

Szilard et al. (2010): Chr12:1059655-1059665

Müller et al. (2010): Chr12:1059425-1060475 (orc1-bah-delta/wt peak ratio: 0.27)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr12:1054720 (Trep: 35.5 min.) (Confidence: 1)

Yabuki et al. (2002): Chr12:1055804 (Trep: 28.9 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-1060 has unique ID: 449

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TAGTTATTACGTTTAGTTATAGTGACTTAGTTTT  
  Eaton et al. (2010):      AGTTATTACGTTTAGTTATAGTGACTTAGTTTT   
ACS LOGO:   ACS_logo  

ARS at XII-1060 has unique ID: 449

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XII-1060 has unique ID: 449

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-1060 has unique ID: 449

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Liachko et al. (2010): PubMed | PubMed Central | PLoS Genet.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XII-1060 has unique ID: 449