Confirmed ARS at II-255

ARS209

Other names: ARSH4, proARS209

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr2:254890-255136
Within tandem intergenic space between YBR008C and YBR009C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -147.5 ΔG° (kcal/mol) at location 255070.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 25.1 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-255 has unique ID: 34

Loading - Please wait...

ARS at II-255 has unique ID: 34

Studies that cloned this origin

Bouton & Smith (1986): Chr2:254744-255118

Nieduszynski et al. (2006): Chr2:254890-255136


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr2:254166-255327

Xu et al. (2006): Chr2:254755-256565

Shor et al. (2009): Chr2:254700-255800 (orc2-1/wt peak ratio: 0.80)

Szilard et al. (2010): Chr2:255085-255095

Müller et al. (2010): Chr2:254525-255875 (orc1-bah-delta/wt peak ratio: 0.57)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr2:258978 (Trep: 25.1 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr2:252666 (Activity detected in: rad53)

Crabbé et al. (2010): Chr2:254890-255136 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-255 has unique ID: 34

Studies that confirmed an essential ACS element

  Bouton & Smith (1986):         TTTTTATGTTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTAATGATGGAATAATTTGGGAATTTACTCTGT  
  Xu et al. (2006):      TCTTTATTTACTTTCTAAAATCCAAATACAAAAC  
  Eaton et al. (2010):      TTTATTTATTTTTATGTTTTGTATTTGGATTTT   
ACS LOGO:   ACS_logo  

ARS at II-255 has unique ID: 34

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at II-255 has unique ID: 34

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-255 has unique ID: 34

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Bouton & Smith (1986): PubMed | PubMed Central

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Bouton & Smith (1986): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at II-255 has unique ID: 34