Confirmed ARS at X-114

ARS1007

Other names: proARS1007

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 9 genome-wide studies.

Genomic Location: Chr10:113226-113828
Within tandem intergenic space between YJL163C and YJL162C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -153.6 ΔG° (kcal/mol) at location 113246.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 32.8 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-114 has unique ID: 333

Loading - Please wait...

ARS at X-114 has unique ID: 333

Studies that cloned this origin

Wyrick et al. (2001): Chr10:113226-113828


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): Chr10:111113-116517


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:113327-114175

Xu et al. (2006): Chr10:111895-116320

Shor et al. (2009): Chr10:113100-114700 (orc2-1/wt peak ratio: 0.51)

Szilard et al. (2010): Chr10:113765-113775

Müller et al. (2010): Chr10:112925-115625 (orc1-bah-delta/wt peak ratio: 0.76)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:108252 (Trep: 32.8 min.) (Confidence: 9)

Alvino et al. (2007): Chr10:113250 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:114000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr10:113226-113828 (Activity detected in: mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-114 has unique ID: 333

Studies that confirmed an essential ACS element

  Xu et al. (2006):         AATATATATTTA                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTAAATATATATTTAGTTATGGAAATTCAATAAA  
  Xu et al. (2006):      TTTTTTACTTTTACCATTTTCTGTAAGAATTTTC  
  Eaton et al. (2010):      TAAATATATATTTAGTTATGGAAATTCAATAAA   
ACS LOGO:   ACS_logo  

ARS at X-114 has unique ID: 333

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at X-114 has unique ID: 333

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-114 has unique ID: 333

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that confirmed an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at X-114 has unique ID: 333