Confirmed ARS at VI-20

ARS600.4

Other names: proARS600.3, proARS600.4

Status: Confirmed ARS: Confirmed by ARS assay and identified by 11 genome-wide studies.

Genomic Location: Chr6:19669-20826
Within convergent intergenic space between YFL055W and YFL054C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -157.8 ΔG° (kcal/mol) at location 19679.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 43.7 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-20 has unique ID: 198

Loading - Please wait...

ARS at VI-20 has unique ID: 198

Studies that cloned this origin

Wyrick et al. (2001): Chr6:19669-20826

Wyrick et al. (2001): Chr6:18682-19864


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:19763-20847

Wyrick et al. (2001): Chr6:18680-19763

Xu et al. (2006): Chr6:18364-22127

Shor et al. (2009): Chr6:20200-21700 (orc2-1/wt peak ratio: 0.50)

Szilard et al. (2010): Chr6:20665-20675

Szilard et al. (2010): Chr6:19185-19195

Müller et al. (2010): Chr6:20150-21575 (orc1-bah-delta/wt peak ratio: 0.50)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:22282 (Trep: 43.7 min.) (Confidence: 4)

Alvino et al. (2007): Chr6:22000 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:21000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr6:19986-20486 (Activity detected in: ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-20 has unique ID: 198

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ATAATTAATATTTTCAATTTTTTACGATTTATAA  
  Eaton et al. (2010):      ATTTTTTACGATTTATAACCTAATTATTAATTT   
ACS LOGO:   ACS_logo  

ARS at VI-20 has unique ID: 198

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-20 has unique ID: 198

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-20 has unique ID: 198

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-20 has unique ID: 198