Confirmed ARS at IV-1503

ARS447

Other names: proARS447

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr4:1502624-1503221
Within tandem intergenic space between YDR533C and YDR534C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -144.6 ΔG° (kcal/mol) at location 1503154.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 28.7 min.
Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-1503 has unique ID: 165

Loading - Please wait...

ARS at IV-1503 has unique ID: 165

Studies that cloned this origin

Shor et al. (2009): Chr4:1502624-1503221


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:1502208-1503361

Xu et al. (2006): Chr4:1501450-1504700

Shor et al. (2009): Chr4:1502400-1504300 (orc2-1/wt peak ratio: 0.84)

Szilard et al. (2010): Chr4:1502895-1502905

Müller et al. (2010): Chr4:1502075-1504025 (orc1-bah-delta/wt peak ratio: 0.58)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr4:1498791 (Trep: 28.7 min.)

Alvino et al. (2007): Chr4:1501300 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:1503000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr4:1503110-1503610 (Activity detected in: mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-1503 has unique ID: 165

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTAACTTTTATTTTCCTTGGCGTCAGATAAAA  
  Xu et al. (2006):      CATATAATTATGTTTTTGTGAGAAATTTTAGCTT  
  Eaton et al. (2010):      TATAATTATGTTTTTGTGAGAAATTTTAGCTTT   
ACS LOGO:   ACS_logo  

ARS at IV-1503 has unique ID: 165

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IV-1503 has unique ID: 165

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-1503 has unique ID: 165

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-1503 has unique ID: 165