Confirmed ARS at IV-1448

ARS441

Other names: proARS441

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr4:1447298-1448928
Within divergent intergenic space between YDR498C and YDR499W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -153.3 ΔG° (kcal/mol) at location 1447678.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.4 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-1448 has unique ID: 157

Loading - Please wait...

ARS at IV-1448 has unique ID: 157

Studies that cloned this origin

Donato et al. (2006): Chr4:1447298-1448928


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:1447042-1447878

Xu et al. (2006): Chr4:1445600-1448700

Shor et al. (2009): Chr4:1445900-1448200 (orc2-1/wt peak ratio: 1.09)

Szilard et al. (2010): Chr4:1447505-1447515

Müller et al. (2010): Chr4:1446500-1448675 (orc1-bah-delta/wt peak ratio: 0.85)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr4:1449620 (Trep: 29.4 min.) (Confidence: 9)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:1446333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr4:1447731-1448231 (Activity detected in: ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-1448 has unique ID: 157

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ATTTTATGTTTAGTTAGGTTTTACCTTGAATTTT  
  Eaton et al. (2010):      AAATTTTATGTTTAGTTAGGTTTTACCTTGAAT   
ACS LOGO:   ACS_logo  

ARS at IV-1448 has unique ID: 157

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IV-1448 has unique ID: 157

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-1448 has unique ID: 157

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Donato et al. (2006): PubMed | PubMed Central | PLoS Genet.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-1448 has unique ID: 157