Confirmed ARS at IV-1166

ARS432.5

Other names: ARS453

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr4:1165998-1166221
Within tandem intergenic space between YDR345C and YDR346C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -145.5 ΔG° (kcal/mol) at location 1166178.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 12.6 min.
Yabuki et al. (2002) — Trep: 17.0 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-1166 has unique ID: 144

Loading - Please wait...

ARS at IV-1166 has unique ID: 144

Studies that cloned this origin

Nieduszynski et al. (2006): Chr4:1165998-1166221


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr4:1165550-1166850

Shor et al. (2009): Chr4:1165700-1166500 (orc2-1/wt peak ratio: 0.44)

Szilard et al. (2010): Chr4:1166165-1166175

Müller et al. (2010): Chr4:1165700-1166975 (orc1-bah-delta/wt peak ratio: 0.29)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr4:1164550 (Trep: 12.6 min.) (Confidence: 9)

Yabuki et al. (2002): Chr4:1162291 (Trep: 17.0 min.)

Alvino et al. (2007): Chr4:1162400 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:1167000 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr4:1165998-1166221 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-1166 has unique ID: 144

Studies that confirmed an essential ACS element

  Nieduszynski et al. (2006):       TTTATTTACATTTTGT                   

Studies that predicted an essential ACS element

  Xu et al. (2006):      ATATTTATTTACATTTTGTCGGAATATTATTTCT  
  Eaton et al. (2010):      TTTATTTACATTTTGTCGGAATATTATTTCTTC   
ACS LOGO:   ACS_logo  

ARS at IV-1166 has unique ID: 144

Alignments from the UCSC genome browser

Confirmed ACS
S. cerevisiaeTCGTAACCCACTTTAGCATATTTATTTACATTTTGTCGGAATATTATTTCTTCTCT
S. kudriavzeviiATGTGGAACTGTTTTCCACATTTATTTACATTTTGTCCGATTTTTATGTCTTTACA
S. mikataeCCATGAGCTTTCTTAACATATATGTTTACGTTTTGTCTT-GTTTTATGTTTTTGCA
S. paradoxusTCCTAAGCTATTTTAGCATATTTATTTACATTTTGTCAGTATTTATTATCTTTTCG
S. bayanusTTTTGTGCTACTTTGTTATATTTATTTACATTTTGTCAGAATTTTGTGTCTTTTAG
*:::**:*:**:*:*****:*******::*:*:*:*:**:::

ARS at IV-1166 has unique ID: 144

These notes are manually curated. To submit notes for this replication origin site please contact us.

Friday, 24th March 2006 - Anne Donaldson:

ARSIV-1166 lies 7kb from another origin, ARSIV-1159. Wyrick et al (2001) identified ARSIV-1159 (as proARS432), but did not identify ARSIV-1166 (which gave some ChIP signal but below thresholds to be assigned as an origin).

ARS at IV-1166 has unique ID: 144

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-1166 has unique ID: 144