Confirmed ARS at III-293

ARS317

Other names: proARS317, proARS318

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 8 genome-wide studies.

Genomic Location: Chr3:292524-292826
Within tandem intergenic space between YCR095C and YCR096C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -137.7 ΔG° (kcal/mol) at location 292694.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 31.1 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-293 has unique ID: 87

Loading - Please wait...

ARS at III-293 has unique ID: 87

Studies that cloned this origin

Poloumienko et al. (2001): Chr3:292379-292917

Nieduszynski et al. (2006): Chr3:292524-292826


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): Chr3:290914-294308


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:293172-293531

Wyrick et al. (2001): Chr3:293043-293725

Shor et al. (2009): Chr3:291000-293900 (orc2-1/wt peak ratio: 1.01)

Szilard et al. (2010): Chr3:292465-292475

Müller et al. (2010): Chr3:291575-293375 (orc1-bah-delta/wt peak ratio: 0.73)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr3:294863 (Trep: 31.1 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:294500 (Activity detected in: rad53)

Crabbé et al. (2010): Chr3:292524-292826 (Activity detected in: ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-293 has unique ID: 87

Studies that confirmed an essential ACS element

  Chang et al. (2008):         TTTTTATATTTA                     

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTGTTTACTTTTTCT                   
  Eaton et al. (2010):      ATTTTTTATATTTAGGTATTAAATTGCGATTTA   
ACS LOGO:   ACS_logo  

ARS at III-293 has unique ID: 87

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTATATATATATATATATTTATTTGTTTACTTTTTCTATCAGTGT------------
S. bayanusCATAAATGTTTATACTGGTATTTGTTTATCTTTTCTAACATTAC------------
:***:**:*:****::::**********::*******:**:*::

ARS at III-293 has unique ID: 87

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-293 has unique ID: 87

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Poloumienko et al. (2001): PubMed | PubMed Central

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): PubMed | PubMed Central


Studies that confirmed an essential ACS element

Chang et al. (2008): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at III-293 has unique ID: 87