Confirmed ARS at XVI-843

ARS1628

Other names: proARS1628

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr16:842646-842894
Within tandem intergenic space between YPR157W and YPR158W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -146.3 ΔG° (kcal/mol) at location 842876.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 21.7 min.
Yabuki et al. (2002) — Trep: 18.7 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XVI-843 has unique ID: 632

Loading - Please wait...

ARS at XVI-843 has unique ID: 632

Studies that cloned this origin

Nieduszynski et al. (2006): Chr16:842646-842894


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr16:842664-843257

Xu et al. (2006): Chr16:841745-843595

Szilard et al. (2010): Chr16:842845-842855

Müller et al. (2010): Chr16:842300-843050 (orc1-bah-delta/wt peak ratio: 0.24)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr16:841672 (Trep: 21.7 min.) (Confidence: 5)

Yabuki et al. (2002): Chr16:847633 (Trep: 18.7 min.)

Alvino et al. (2007): Chr16:846440 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr16:842000 (Activity detected in: wild-type, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XVI-843 has unique ID: 632

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTATTTAGATTTAGT                   
  Xu et al. (2006):      TTTTTTATCATATTTTGTGCTTGTGTGTTTATTT  
  Xu et al. (2006):      TTTTTATGTTTTTCAACATAGTTTTTAATGTGTT  
ACS LOGO:   ACS_logo  

ARS at XVI-843 has unique ID: 632

Alignments from the UCSC genome browser

Predicted ACS
*

ARS at XVI-843 has unique ID: 632

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XVI-843 has unique ID: 632

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XVI-843 has unique ID: 632