Confirmed ARS at XIV-764

ARS1429

Other names: proARS1429

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr14:764001-764500
Within divergent intergenic space between YNR069C and YNR070W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -148.8 ΔG° (kcal/mol) at location 764081.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.3 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIV-764 has unique ID: 538

Loading - Please wait...

ARS at XIV-764 has unique ID: 538

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr14:764001-764500


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr14:763980-765372

Xu et al. (2006): Chr14:763355-765235

Shor et al. (2009): Chr14:763600-765000 (orc2-1/wt peak ratio: 0.60)

Szilard et al. (2010): Chr14:764495-764505

Müller et al. (2010): Chr14:763475-764975 (orc1-bah-delta/wt peak ratio: 0.42)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr14:769897 (Trep: 29.3 min.) (Confidence: 3)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr14:763000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIV-764 has unique ID: 538

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      CTGACATTTTTTATTTTGTTTCATCTTTGTGATT  
  Eaton et al. (2010):      ACATTTTTTATTTTGTTTCATCTTTGTGATTTT   
ACS LOGO:   ACS_logo  

ARS at XIV-764 has unique ID: 538

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XIV-764 has unique ID: 538

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIV-764 has unique ID: 538

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIV-764 has unique ID: 538