Confirmed ARS at XIV-739

ARS1428.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr14:738550-738982
Within tandem intergenic space between YNR059W and YNR060W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -146.8 ΔG° (kcal/mol) at location 738850.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 30.1 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIV-739 has unique ID: 537

Loading - Please wait...

ARS at XIV-739 has unique ID: 537

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr14:738550-738982


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr14:737005-740235

Shor et al. (2009): Chr14:737500-739600 (orc2-1/wt peak ratio: 0.75)

Szilard et al. (2010): Chr14:738845-738855

Müller et al. (2010): Chr14:737600-739475 (orc1-bah-delta/wt peak ratio: 0.80)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr14:740469 (Trep: 30.1 min.)

Alvino et al. (2007): Chr14:739140 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr14:739333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr14:738508-739008 (Activity detected in: mrc1-AQ, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIV-739 has unique ID: 537

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Eaton et al. (2010):      CGCATTTATATTTAGTTAACATTATGTGAAATT   
ACS LOGO:   ACS_logo  

ARS at XIV-739 has unique ID: 537

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XIV-739 has unique ID: 537

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIV-739 has unique ID: 537

Genome-wide studies that identified this origin

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIV-739 has unique ID: 537