Confirmed ARS at XIV-127

ARS1410

Other names: proARS1410

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr14:126488-126981
Within convergent intergenic space between YNL273W and YNL272C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -156.2 ΔG° (kcal/mol) at location 126488.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 30.4 min.
Yabuki et al. (2002) — Trep: 29.9 min.
Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIV-127 has unique ID: 508

Loading - Please wait...

ARS at XIV-127 has unique ID: 508

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr14:126488-126981


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr14:126597-126803

Xu et al. (2006): Chr14:125625-127805

Szilard et al. (2010): Chr14:126665-126675


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr14:134275

Raghuraman et al. (2001): Chr14:126274 (Trep: 30.4 min.) (Confidence: 1)

Yabuki et al. (2002): Chr14:123469 (Trep: 29.9 min.)

Alvino et al. (2007): Chr14:128670 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr14:127000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr14:126613-127113 (Activity detected in: mrc1-AQ, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIV-127 has unique ID: 508

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TGTTTTAATATTATGTCAATACTTTGAACTTAAA  
ACS LOGO:   ACS_logo  

ARS at XIV-127 has unique ID: 508

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XIV-127 has unique ID: 508

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIV-127 has unique ID: 508

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XIV-127 has unique ID: 508