Confirmed ARS at XIII-555

ARS1322

Other names: proARS1322

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr13:554392-554750
Within convergent intergenic space between YMR144W and YMR145C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -137.4 ΔG° (kcal/mol) at location 554412.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIII-555 has unique ID: 478

Loading - Please wait...

ARS at XIII-555 has unique ID: 478

Studies that cloned this origin

Liachko et al. (2010): Chr13:554392-554750


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr13:553421-554330

Xu et al. (2006): Chr13:553565-556235

Shor et al. (2009): Chr13:554100-556400 (orc2-1/wt peak ratio: 0.53)

Szilard et al. (2010): Chr13:554435-554445

Müller et al. (2010): Chr13:553925-555425 (orc1-bah-delta/wt peak ratio: 0.59)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr13:555000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr13:554612-555112 (Activity detected in: rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIII-555 has unique ID: 478

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Eaton et al. (2010):      ATAATTTATCATTTGTTGCCTCAAACTGATATT   
ACS LOGO:   ACS_logo  

ARS at XIII-555 has unique ID: 478

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XIII-555 has unique ID: 478

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIII-555 has unique ID: 478

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Liachko et al. (2010): PubMed | PubMed Central | PLoS Genet.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIII-555 has unique ID: 478