Confirmed ARS at XIII-94

ARS1305

Other names: proARS1305

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr13:94216-94463
Within convergent intergenic space between YML088W and YML087C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -146.3 ΔG° (kcal/mol) at location 94436.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 22.9 min.
Yabuki et al. (2002) — Trep: 27.6 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIII-94 has unique ID: 457

Loading - Please wait...

ARS at XIII-94 has unique ID: 457

Studies that cloned this origin

Nieduszynski et al. (2006): Chr13:94216-94463


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr13:94602-95145

Xu et al. (2006): Chr13:93797-95102

Szilard et al. (2010): Chr13:94555-94565


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr13:92762 (Trep: 22.9 min.) (Confidence: 9)

Yabuki et al. (2002): Chr13:94074 (Trep: 27.6 min.)

Alvino et al. (2007): Chr13:90889 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr13:94000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr13:94216-94463 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIII-94 has unique ID: 457

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTAATTATATTTAGAT                   
  Xu et al. (2006):      ATTAATTATATTTAGATATATATTCGTATTTTAT  
ACS LOGO:   ACS_logo  

ARS at XIII-94 has unique ID: 457

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeATTTTTCATGTAAATAAGCATTAATTATATTTAGATATATATTCGTATTTTATTAA
S. kudriavzeviiTTTTCGCGTGTAAATA--CATAAATGATATTTAGATATATATTCATGCTGA--TAA
S. mikataeATTTTCTATGTAAATA-GCATTAATTATGTTTTTATATATATTCCTTATTT-TTAA
S. paradoxusATTTCCCATGTAAATAAGCATTAATCATATTTAGATATATATTCGTAATTT-TTAA
S. bayanusGTTTTTCATGTAGATAATAATTAATTATATTTAGATATATATTCATGACATTTTAA
***::****:***:**:*****:***::***********:::::***

ARS at XIII-94 has unique ID: 457

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIII-94 has unique ID: 457

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XIII-94 has unique ID: 457