Confirmed ARS at XIII-40

ARS1304

Other names: proARS1304

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr13:39922-40355
Within convergent intergenic space between YML116W and YML115C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -153.0 ΔG° (kcal/mol) at location 40352.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 27.4 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIII-40 has unique ID: 455

Loading - Please wait...

ARS at XIII-40 has unique ID: 455

Studies that cloned this origin

Liachko et al. (2010): Chr13:39922-40355


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr13:39824-40187

Xu et al. (2006): Chr13:38726-40442

Shor et al. (2009): Chr13:38400-40800 (orc2-1/wt peak ratio: 0.61)

Szilard et al. (2010): Chr13:39915-39925

Müller et al. (2010): Chr13:38525-40400 (orc1-bah-delta/wt peak ratio: 0.62)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr13:37255 (Trep: 27.4 min.) (Confidence: 9)

Alvino et al. (2007): Chr13:33500 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr13:39678-40178 (Activity detected in: rev3 rad30, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIII-40 has unique ID: 455

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TAATTTTTTGTTTTGTTTTATTTCGTTTTGTTTT  
ACS LOGO:   ACS_logo  

ARS at XIII-40 has unique ID: 455

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XIII-40 has unique ID: 455

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIII-40 has unique ID: 455

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Liachko et al. (2010): PubMed | PubMed Central | PLoS Genet.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XIII-40 has unique ID: 455