Confirmed ARS at XII-623

ARS1219

Other names: proARS1219

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr12:622672-623123
Within convergent intergenic space between YLR241W and YLR242C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -153.6 ΔG° (kcal/mol) at location 622712.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 24.4 min.
Alvino et al. (2007) — Peak first observed at 25.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-623 has unique ID: 422

Loading - Please wait...

ARS at XII-623 has unique ID: 422

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr12:622672-623123


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr12:623198-623861

Xu et al. (2006): Chr12:622105-623935

Shor et al. (2009): Chr12:622600-623100 (orc2-1/wt peak ratio: 0.00)

Szilard et al. (2010): Chr12:622975-622985

Müller et al. (2010): Chr12:622400-623150 (orc1-bah-delta/wt peak ratio: 0.57)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr12:619804 (Trep: 24.4 min.)

Alvino et al. (2007): Chr12:617500 (Peak first observed at 25.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr12:623000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr12:622946-623446 (Activity detected in: wild-type, rev3 rad30, eco1, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-623 has unique ID: 422

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTATATATTTTGTTGTGAAAATGCCAAAATAAG  
ACS LOGO:   ACS_logo  

ARS at XII-623 has unique ID: 422

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XII-623 has unique ID: 422

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-623 has unique ID: 422

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XII-623 has unique ID: 422