Likely ARS at XI-633

No systematic name assigned

Other names: proARS1122

Status: Likely ARS: Identified by 8 genome-wide studies.

Genomic Location: Chr11:632003-634377
Probably within convergent intergenic space between YKR097W and YKR098C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -155.9 ΔG° (kcal/mol) at location 634033.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 32.6 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XI-633 has unique ID: 390

Loading - Please wait...

ARS at XI-633 has unique ID: 390

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr11:633097-634230

Xu et al. (2006): Chr11:632005-634375

Shor et al. (2009): Chr11:633500-634200 (orc2-1/wt peak ratio: 0.11)

Szilard et al. (2010): Chr11:633355-633365

Müller et al. (2010): Chr11:633200-634100 (orc1-bah-delta/wt peak ratio: 0.64)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr11:640575 (Trep: 32.6 min.) (Confidence: 9)

Alvino et al. (2007): Chr11:639170 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr11:632867-633367 (Activity detected in: mrc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XI-633 has unique ID: 390

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTCCCGCTCGATTTACGTTTTGTTCAAAAAAAT  
ACS LOGO:   ACS_logo  

ARS at XI-633 has unique ID: 390

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XI-633 has unique ID: 390

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XI-633 has unique ID: 390

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XI-633 has unique ID: 390