Confirmed ARS at II-326

ARS211

Other names: proARS211

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr2:326099-326335
Within tandem intergenic space between YBR044C and TV(UAC)B.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -151.6 ΔG° (kcal/mol) at location 326289.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 28.1 min.
Yabuki et al. (2002) — Trep: 27.0 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-326 has unique ID: 37

Loading - Please wait...

ARS at II-326 has unique ID: 37

Studies that cloned this origin

Nieduszynski et al. (2006): Chr2:326099-326335


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr2:326016-326749

Xu et al. (2006): Chr2:324655-326845

Szilard et al. (2010): Chr2:325995-326005


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr2:326882 (Trep: 28.1 min.) (Confidence: 9)

Yabuki et al. (2002): Chr2:324478 (Trep: 27.0 min.)

Alvino et al. (2007): Chr2:322000 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr2:324666 (Activity detected in: rad53)

Crabbé et al. (2010): Chr2:326099-326335 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-326 has unique ID: 37

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATTTTTTACATTTTTT                   
  Xu et al. (2006):      CCGAGATTTTCAATCCTATAAGAATTACCTAAAC  
ACS LOGO:   ACS_logo  

ARS at II-326 has unique ID: 37

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeGAATGGAAGAAAGGGCCTTTATTTTTTACATTTTTTTAAGCCATAACGGATTTTAG
S. kudriavzeviiGCATGGTAGACACACCCTTTTTTTTCTACAATTTTTTAAGCTTTGACGGATTTTCA
S. mikataeTAAT------AATGCCCT---TTTTTTACATTTTTTTAAGCCATAACAGATTTTAT
S. paradoxusGCATGGTAGAAGCAGCCTTTATTTTTTACATTTTTTAAAGCCATAACGGATTTAAA
S. bayanusGTAACCAAAATTTACCCTTAAA--TCCACATTTTTTCAAGCCATAACGGATTTTTC
:*::::***::::*:***:*********::*:**:*****::

ARS at II-326 has unique ID: 37

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-326 has unique ID: 37

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at II-326 has unique ID: 37