Confirmed ARS at X-712

ARS1022

Other names: proARS1022

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr10:711590-711837
Within tandem intergenic space between YJR150C and YJR151C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -135.0 ΔG° (kcal/mol) at location 711720.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 31.7 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-712 has unique ID: 355

Loading - Please wait...

ARS at X-712 has unique ID: 355

Studies that cloned this origin

Nieduszynski et al. (2006): Chr10:711590-711837


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:710670-711944

Xu et al. (2006): Chr10:710865-713260

Shor et al. (2009): Chr10:711400-713700 (orc2-1/wt peak ratio: 0.49)

Szilard et al. (2010): Chr10:711675-711685

Müller et al. (2010): Chr10:711800-712325 (orc1-bah-delta/wt peak ratio: 0.35)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:707767 (Trep: 31.7 min.) (Confidence: 4)

Alvino et al. (2007): Chr10:718860 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:712666 (Activity detected in: rad53)

Crabbé et al. (2010): Chr10:711590-711837 (Activity detected in: ctf8, ctf18, mrc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-712 has unique ID: 355

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATTTTTAATGTTTTCT                   
ACS LOGO:   ACS_logo  

ARS at X-712 has unique ID: 355

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeGCTGAAGCCCATATTGTGATATTTTTAATGTTTTCTTAGAAAAATTAAAAAACTTC
S. mikataeGTTTAAGCACTTATCTTGAAATTTT--ATGTTTTGTTAAAAAAATTGTCAATGTTA
S. paradoxusA-TAAAGCCCATATTTGAAATTTTT--ATGTTTTATTAGATAACTCAAAAAATTT-
:*****:*:***:::*:**************:*:**:*::::**:**

ARS at X-712 has unique ID: 355

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-712 has unique ID: 355

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at X-712 has unique ID: 355