Confirmed ARS at IX-311

ARS916

Other names: proARS917

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr9:310583-311070
Within divergent intergenic space between YIL023C and YIL022W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -156.4 ΔG° (kcal/mol) at location 310923.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 36.9 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IX-311 has unique ID: 318

Loading - Please wait...

ARS at IX-311 has unique ID: 318

Studies that cloned this origin

Shor et al. (2009): Chr9:310583-311070


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr9:310424-311163

Xu et al. (2006): Chr9:308195-311475

Shor et al. (2009): Chr9:310300-311400 (orc2-1/wt peak ratio: 0.35)

Szilard et al. (2010): Chr9:310795-310805

Müller et al. (2010): Chr9:310250-311300 (orc1-bah-delta/wt peak ratio: 0.51)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr9:306260 (Trep: 36.9 min.) (Confidence: 5)

Alvino et al. (2007): Chr9:309750 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr9:309333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr9:310629-311129 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IX-311 has unique ID: 318

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      AAATTTTATGTTATGGCCAAAAAAAGAAAGTTTC  
ACS LOGO:   ACS_logo  

ARS at IX-311 has unique ID: 318

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IX-311 has unique ID: 318

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IX-311 has unique ID: 318

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at IX-311 has unique ID: 318