Confirmed ARS at IX-246

ARS913.5

Other names: ARS923

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr9:245694-245932
Within tandem intergenic space between YIL061C and YIL057C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -145.1 ΔG° (kcal/mol) at location 245714.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 24.3 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IX-246 has unique ID: 313

Loading - Please wait...

ARS at IX-246 has unique ID: 313

Studies that cloned this origin

Nieduszynski et al. (2006): Chr9:245694-245932


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr9:244105-249175

Shor et al. (2009): Chr9:244800-249100 (orc2-1/wt peak ratio: 0.76)

Szilard et al. (2010): Chr9:245955-245965

Müller et al. (2010): Chr9:244550-248975 (orc1-bah-delta/wt peak ratio: 0.75)

Müller et al. (2010): Chr9:244550-248975


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr9:249591 (Trep: 24.3 min.)

Alvino et al. (2007): Chr9:247750 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr9:246750 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr9:245694-245932 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IX-246 has unique ID: 313

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTAATGTTTTGTC                   
  Xu et al. (2006):      TTTTTTAATGTTTTGTCCTTATAACGCGACTTAT  
  Eaton et al. (2010):      TTTTTTAATGTTTTGTCCTTATAACGCGACTTA   
ACS LOGO:   ACS_logo  

ARS at IX-246 has unique ID: 313

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeAGTGAATCAATACATATTTTTTTTTAATGTTTTGTCCTTATAACGCGACTTATTCA
S. kudriavzeviiTGCGTAACCAT---------TTTTTTATGTTTTGTACACACATCGCGACTTTTTTT
S. mikatae----------------TTTCTTTTTAATGTTTTGTCTTTACAAGGCGACCTT----
S. paradoxusAATAAATCAACACATATTATTTTTTTATGTTTAGTCTTAACAACGCGACCTT----
S. bayanusAACGTATCTGTATATATTATTTTTTAATATTTTGTCTTCACAGCGCAAACTTCTCT
::::*******:***:**::*:*:**:*:*::

ARS at IX-246 has unique ID: 313

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IX-246 has unique ID: 313

Genome-wide studies that identified this origin

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IX-246 has unique ID: 313