Confirmed ARS at VII-1084

ARS131a

Other names: X-ARS, proARS736

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr7:1082959-1084336
Within divergent intergenic space between YGR295C and YGR296W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -155.8 ΔG° (kcal/mol) at location 1083859.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 28.8 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at VII-1084 has unique ID: 261

Loading - Please wait...

ARS at VII-1084 has unique ID: 261

Studies that cloned this origin

Study details not curated: Chr7:1082959-1084336


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:1083792-1084860

Xu et al. (2006): Chr7:1079700-1085000

Shor et al. (2009): Chr7:1082700-1084500 (orc2-1/wt peak ratio: 0.84)

Szilard et al. (2010): Chr7:1083195-1083205

Müller et al. (2010): Chr7:1082675-1084625 (orc1-bah-delta/wt peak ratio: 0.71)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr7:1079647 (Trep: 28.8 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-1084 has unique ID: 261

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTATGTTTAGGTGATTTTGATGATATTTTTA  
  Eaton et al. (2010):      TATTTTTATGTTTAGGTGATTTTGATGATATTT   
ACS LOGO:   ACS_logo  

ARS at VII-1084 has unique ID: 261

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VII-1084 has unique ID: 261

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-1084 has unique ID: 261

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VII-1084 has unique ID: 261