Confirmed ARS at VII-389

ARS717

Other names: proARS717

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr7:388658-388892
Within convergent intergenic space between YGL062W and YGL061C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -137.6 ΔG° (kcal/mol) at location 388668.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 30.5 min.
Yabuki et al. (2002) — Trep: 24.1 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-389 has unique ID: 233

Loading - Please wait...

ARS at VII-389 has unique ID: 233

Studies that cloned this origin

Nieduszynski et al. (2006): Chr7:388658-388892


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:388730-388966

Xu et al. (2006): Chr7:387465-389765

Shor et al. (2009): Chr7:385600-389100 (orc2-1/wt peak ratio: 0.74)

Szilard et al. (2010): Chr7:388905-388915


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:393919 (Trep: 30.5 min.) (Confidence: 9)

Yabuki et al. (2002): Chr7:389647 (Trep: 24.1 min.)

Alvino et al. (2007): Chr7:391220 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr7:390250 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr7:388658-388892 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-389 has unique ID: 233

Studies that confirmed an essential ACS element

  Nieduszynski et al. (2006):       TTTATTTAACTTTTGT                   

Studies that predicted an essential ACS element

None curated.

ACS LOGO:   ACS_logo  


ARS at VII-389 has unique ID: 233

Alignments from the UCSC genome browser

Confirmed ACS
S. cerevisiaeGTTAAATTATTATTTTTTTTTTTATTTAACTTTTGTTCCTAATTATGTATTAGTAT
S. kudriavzeviiGTTTAGTTTTTTTTTTCTTCTTTATTTAACTTTTGTCCCTG-CTATGTATTATTAC
S. mikataeGTTTGATTTTTTTCTACTTTTTTATTTAATTTTTGTTCGTAATTATGTATCAAAGG
S. paradoxusGTTGAATTTTTTTTCTGTTTTTTATTTAACTTTTGTCCCTAATTATGTATTTGTAA
S. bayanusTTTTTGTTTATTTTTTTGTTTTTATTTAACTCTAGTCCTTAATTATGTATTATTGA
:**:**::*:*::::*:*********:*:*:****:::*******::::

ARS at VII-389 has unique ID: 233

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-389 has unique ID: 233

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that predicted an essential ACS element

None identified.


ARS at VII-389 has unique ID: 233