Confirmed ARS at VII-18

ARS700.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr7:17629-18112
Within tandem intergenic space between YGL256W and YGL255W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -143.4 ΔG° (kcal/mol) at location 18039.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 31.8 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-18 has unique ID: 214

Loading - Please wait...

ARS at VII-18 has unique ID: 214

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr7:17629-18112


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr7:15329-19622

Shor et al. (2009): Chr7:17100-18800 (orc2-1/wt peak ratio: 0.75)

Szilard et al. (2010): Chr7:17715-17725

Müller et al. (2010): Chr7:16625-18725 (orc1-bah-delta/wt peak ratio: 0.73)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:15756 (Trep: 31.8 min.) (Confidence: 9)

Alvino et al. (2007): Chr7:17000 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr7:17000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr7:17595-18095 (Activity detected in: elg1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-18 has unique ID: 214

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Eaton et al. (2010):      ATTATTATGGTTTAGTTATAGAAGTTCATCATT   
ACS LOGO:   ACS_logo  

ARS at VII-18 has unique ID: 214

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VII-18 has unique ID: 214

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-18 has unique ID: 214

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VII-18 has unique ID: 214