Confirmed ARS at VI-128

ARS604

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 7 genome-wide studies.

Genomic Location: Chr6:127745-128066
Within gene: YFL007W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -145.8 ΔG° (kcal/mol) at location 127865.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 21.5 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-128 has unique ID: 205

Loading - Please wait...

ARS at VI-128 has unique ID: 205

Studies that cloned this origin

Shirahige et al. (1993): Chr6:127745-128066


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:125914-132085


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr6:127725-129315

Shor et al. (2009): Chr6:127400-128600 (orc2-1/wt peak ratio: 0.07)

Szilard et al. (2010): Chr6:128235-128245

Müller et al. (2010): Chr6:127475-128375 (orc1-bah-delta/wt peak ratio: 1.34)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr6:122427 (Trep: 21.5 min.) (Confidence: 9)

Alvino et al. (2007): Chr6:122670 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr6:127745-128066 (Activity detected in: rev3 rad30, eco1, ctf4, ddc1, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-128 has unique ID: 205

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         TTTTACGTTTTG                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TCATTTTACGTTTTGTTACACAAATCCAATCGAA  
  Eaton et al. (2010):      TCATTTTACGTTTTGTTACACAAATCCAATCGA   
ACS LOGO:   ACS_logo  

ARS at VI-128 has unique ID: 205

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-128 has unique ID: 205

These notes are manually curated. To submit notes for this replication origin site please contact us.

Thursday, 17th August 2006 - Conrad Nieduszynski:

2D gel studies indicate that ARS604 has barely detectable origin activity, while its two flanking origins (ARS603.5 and ARS605) have robust origin activity (see Yamashita et al., 1997 and Friedman et al., 1997 in the References tab). [Thanks to Joel Huberman for this information.]

ARS at VI-128 has unique ID: 205

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-128 has unique ID: 205