Confirmed ARS at III-13

ARS302

Other names: proARS301, proARS302, proARS303/proARS320

Status: Confirmed ARS: Confirmed by ARS assay and identified by 15 genome-wide studies.

Genomic Location: Chr3:11303-14854
Resolution insufficient to assign intergenic space.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -163.2 ΔG° (kcal/mol) at location 11853.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-13 has unique ID: 791

Loading - Please wait...

ARS at III-13 has unique ID: 791

Studies that cloned this origin

Study details not curated: Chr3:14574-14849

Study details not curated: Chr3:11145-11401

Newlon et al. (1991): Chr3:9675-11309

Newlon et al. (1991): Chr3:14848-16279

Newlon et al. (1991): Chr3:11303-14854


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:14947-15787

Wyrick et al. (2001): Chr3:14108-14947

Wyrick et al. (2001): Chr3:11072-11493

Xu et al. (2006): Chr3:25-17053

Shor et al. (2009): Chr3:9400-17000 (orc2-1/wt peak ratio: 0.79)

Szilard et al. (2010): Chr3:13135-13145

Szilard et al. (2010): Chr3:15015-15025

Szilard et al. (2010): Chr3:11435-11445

Müller et al. (2010): Chr3:12650-15950

Müller et al. (2010): Chr3:10475-12350

Müller et al. (2010): Chr3:12650-15950 (orc1-bah-delta/wt peak ratio: 0.31)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:12666 (Activity detected in: rad53)

Crabbé et al. (2010): Chr3:15213-16274

Crabbé et al. (2010): Chr3:14574-14849 (Activity detected in: ctf18 rad9, mec1-100, rad53, mec1)

Crabbé et al. (2010): Chr3:14870-15213


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-13 has unique ID: 791

Studies that confirmed an essential ACS element

  Sharma et al. (2001):         TTTTATATTTTC                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTGTTTATGTCTATGTATTTGTATAAAATATGA  
ACS LOGO:   ACS_logo  

ARS at III-13 has unique ID: 791

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-13 has unique ID: 791

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-13 has unique ID: 791

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Newlon et al. (1991): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Sharma et al. (2001): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-13 has unique ID: 791