Likely ARS at VII-33

No systematic name assigned

Status: Likely ARS: Identified by 6 genome-wide studies.

Genomic Location: Chr7:31980-34434
Probably within tandem intergenic space between YGL250W and YGL249W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -159.8 ΔG° (kcal/mol) at location 31990.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 34.8 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-33 has unique ID: 685

Loading - Please wait...

ARS at VII-33 has unique ID: 685

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr7:31982-34432

Szilard et al. (2010): Chr7:32925-32935

Müller et al. (2010): Chr7:32600-33050 (orc1-bah-delta/wt peak ratio: 0.18)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:29262 (Trep: 34.8 min.) (Confidence: 1)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr7:33000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr7:32205-32705 (Activity detected in: ctf8, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-33 has unique ID: 685

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TGTATTATTGTTTTGTATTGTTTTTTCGTCATTT  
ACS LOGO:   ACS_logo  

ARS at VII-33 has unique ID: 685

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VII-33 has unique ID: 685

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-33 has unique ID: 685

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VII-33 has unique ID: 685