Confirmed ARS at III-15

ARS303

Other names: proARS302, proARS303/proARS320

Status: Confirmed ARS: Confirmed by ARS assay and identified by 11 genome-wide studies.

Genomic Location: Chr3:14870-15213
Within convergent intergenic space between YCL066W and YCL064C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -139.7 ΔG° (kcal/mol) at location 15000.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-15 has unique ID: 67

Loading - Please wait...

ARS at III-15 has unique ID: 67

Studies that cloned this origin

Study details not curated: Chr3:14870-15213

Newlon et al. (1991): Chr3:14848-16279


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:14108-14947

Wyrick et al. (2001): Chr3:14947-15787

Xu et al. (2006): Chr3:25-17053

Shor et al. (2009): Chr3:9400-17000 (orc2-1/wt peak ratio: 0.79)

Szilard et al. (2010): Chr3:15015-15025

Müller et al. (2010): Chr3:12650-15950

Müller et al. (2010): Chr3:12650-15950 (orc1-bah-delta/wt peak ratio: 0.31)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:12666 (Activity detected in: rad53)

Crabbé et al. (2010): Chr3:15213-16274

Crabbé et al. (2010): Chr3:14870-15213

Crabbé et al. (2010): Chr3:14574-14849 (Activity detected in: ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-15 has unique ID: 67

Studies that confirmed an essential ACS element

  Vujcic et al. (1999):         TATTTATATTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      GGTATTTATATTTTGCCGACATTTGCAGCTCTTT  
ACS LOGO:   ACS_logo  

ARS at III-15 has unique ID: 67

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-15 has unique ID: 67

These notes are manually curated. To submit notes for this replication origin site please contact us.

Friday, 18th August 2006 - Conrad Nieduszynski:

2D gel analysis indicates that ARS303 (like ARS301, ARS302 & ARS320) does NOT normally serve as chromosomal replication origin (see Dubey et al., 1991 in References tab). [Thanks to Carol Newlon for this information.]

ARS at III-15 has unique ID: 67

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Newlon et al. (1991): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Vujcic et al. (1999): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-15 has unique ID: 67