Confirmed ARS at III-11

ARS301

Other names: proARS301

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr3:11145-11401
Within convergent intergenic space between YCL069W and YCL068C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -140.0 ΔG° (kcal/mol) at location 11365.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-11 has unique ID: 65

Loading - Please wait...

ARS at III-11 has unique ID: 65

Studies that cloned this origin

Study details not curated: Chr3:11145-11401

Newlon et al. (1991): Chr3:11303-14854

Newlon et al. (1991): Chr3:9675-11309


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:11072-11493

Xu et al. (2006): Chr3:25-17053

Shor et al. (2009): Chr3:9400-17000 (orc2-1/wt peak ratio: 0.79)

Szilard et al. (2010): Chr3:11435-11445

Müller et al. (2010): Chr3:10475-12350 (orc1-bah-delta/wt peak ratio: 0.70)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:12666 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-11 has unique ID: 65

Studies that confirmed an essential ACS element

  Sharma et al. (2001):         TTTTATGTTTTT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTTTATGTTTTTTTAAAACATTAAAGTTTTC  
  Eaton et al. (2010):      TTTTTTTATGTTTTTTTAAAACATTAAAGTTTT   
ACS LOGO:   ACS_logo  

ARS at III-11 has unique ID: 65

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-11 has unique ID: 65

These notes are manually curated. To submit notes for this replication origin site please contact us.

Thursday, 17th August 2006 - Conrad Nieduszynski:

David Kowalski's lab showed, by 2D gel analysis, that ARS301 is programmed to fire so late that in wild-type cells it is always replicated (in late S) by forks from ARS305 (ARS at III-39) before it has a chance to fire on its own (see Vujcic et al. (1999) in references tab). [Thanks to Joel Huberman for this information.]

Thursday, 17th August 2006 - Conrad Nieduszynski:

2D gel analysis indicates that ARS301 (like ARS302, ARS303 & ARS320) does NOT normally serve as chromosomal replication origin (see Dubey et al., 1991 in References tab). [Thanks to Joel Huberman & Carol Newlon for this information.]

ARS at III-11 has unique ID: 65

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Newlon et al. (1991): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Sharma et al. (2001): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at III-11 has unique ID: 65