Likely ARS at XV-1081

No systematic name assigned

Other names: proARS1530

Status: Likely ARS: Identified by 7 genome-wide studies.

Genomic Location: Chr15:1077498-1085252
Resolution insufficient to assign intergenic space.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -166.9 ΔG° (kcal/mol) at location 1082848.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 26.7 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XV-1081 has unique ID: 586

Loading - Please wait...

ARS at XV-1081 has unique ID: 586

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr15:1077903-1078537

Xu et al. (2006): Chr15:1077500-1085250

Shor et al. (2009): Chr15:1082500-1084800 (orc2-1/wt peak ratio: 0.87)

Szilard et al. (2010): Chr15:1083715-1083725

Müller et al. (2010): Chr15:1083050-1084850 (orc1-bah-delta/wt peak ratio: 0.77)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr15:1075721 (Trep: 26.7 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr15:1087000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-1081 has unique ID: 586

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTATGTTTAGGTGATTTTGATGGTGATTTTT  
  Xu et al. (2006):      AATTCATATTTATTTCCCATGTACCAATTAATTA  
  Xu et al. (2006):      TTTTCATTTTTTGGCGCGTCGCCTCGGGGTCGTT  
ACS LOGO:   ACS_logo  

ARS at XV-1081 has unique ID: 586

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XV-1081 has unique ID: 586

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-1081 has unique ID: 586

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XV-1081 has unique ID: 586