Confirmed ARS at XV-982

ARS1529

Other names: proARS1529

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr15:981454-981690
Within tandem intergenic space between TP(UGG)O3 and YOR346W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -143.2 ΔG° (kcal/mol) at location 981594.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 26.7 min.
Yabuki et al. (2002) — Trep: 24.5 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XV-982 has unique ID: 583

Loading - Please wait...

ARS at XV-982 has unique ID: 583

Studies that cloned this origin

Nieduszynski et al. (2006): Chr15:981454-981690


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr15:981804-982154

Xu et al. (2006): Chr15:980455-982865

Szilard et al. (2010): Chr15:981675-981685


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr15:987761 (Trep: 26.7 min.) (Confidence: 9)

Yabuki et al. (2002): Chr15:981221 (Trep: 24.5 min.)

Alvino et al. (2007): Chr15:982890 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr15:981333 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-982 has unique ID: 583

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTATTTATATTTTTCT                   
ACS LOGO:   ACS_logo  

ARS at XV-982 has unique ID: 583

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeAACTTGCTGATGTCCTTTTTTTATTTATATTTTTCTTCAGTGAAGCGATTTTTTTT
S. kudriavzeviiAGCTTGCTAGTATCCTTCTCTTATTTATAATTTTCTTCAGATTATCAATTTTCA--
S. mikataeGATTCGCGGATGTCTTTCTTTTTTTTATATTTTTCTTCACTACATCAATTTTGAAG
S. paradoxusAATTTGCTGATGTCCTCGTTTTATTTATATTTTTCTTCAGCGGATCAATTTTCA--
S. bayanusAGTTTACTGAGACCTTTCTTATATTTATATTTTTCTTCATTTTCTTAATTTTCG--
:*::*:::::**::*::*:******:*********:::::*****::::

ARS at XV-982 has unique ID: 583

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-982 has unique ID: 583

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at XV-982 has unique ID: 583