Confirmed ARS at II-676

ARS221.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr2:675947-676667
Within convergent intergenic space between YBR228W and YBR229C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -156.2 ΔG° (kcal/mol) at location 676087.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 42.4 min.
Yabuki et al. (2002) — Trep: 36.9 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-676 has unique ID: 52

Loading - Please wait...

ARS at II-676 has unique ID: 52

Studies that cloned this origin

Xu et al. (2006): Chr2:675947-676667


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr2:675935-676775

Szilard et al. (2010): Chr2:676185-676195


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr2:673522 (Trep: 42.4 min.) (Confidence: 7)

Yabuki et al. (2002): Chr2:674478 (Trep: 36.9 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr2:675947-676667 (Activity detected in: ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-676 has unique ID: 52

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TAAAGATATCACTTCGTTTTTTTCCCTCAAAAAA  
ACS LOGO:   ACS_logo  

ARS at II-676 has unique ID: 52

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at II-676 has unique ID: 52

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-676 has unique ID: 52

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at II-676 has unique ID: 52