Confirmed ARS at XIII-184

ARS1308

Other names: proARS1308

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr13:183793-184037
Resolution insufficient to assign intergenic space.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -160.7 ΔG° (kcal/mol) at location 183893.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 12.3 min.
Yabuki et al. (2002) — Trep: 20.9 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIII-184 has unique ID: 461

Loading - Please wait...

ARS at XIII-184 has unique ID: 461

Studies that cloned this origin

Nieduszynski et al. (2006): Chr13:183793-184037


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr13:183968-184170

Shor et al. (2009): Chr13:183400-184300 (orc2-1/wt peak ratio: 0.81)

Müller et al. (2010): Chr13:183500-184175 (orc1-bah-delta/wt peak ratio: 1.07)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr13:180774 (Trep: 12.3 min.) (Confidence: 9)

Yabuki et al. (2002): Chr13:183574 (Trep: 20.9 min.)

Alvino et al. (2007): Chr13:180110 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr13:182000 (Activity detected in: wild-type, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIII-184 has unique ID: 461

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTATATATGGTTAGTT                   
  Eaton et al. (2010):      ATATTTAATGTTTAGAAGTTGTTTTACATATTT   
ACS LOGO:   ACS_logo  

ARS at XIII-184 has unique ID: 461

Alignments from the UCSC genome browser

Predicted ACS
*

ARS at XIII-184 has unique ID: 461

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIII-184 has unique ID: 461

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIII-184 has unique ID: 461