Confirmed ARS at XII-1014

ARS1233

Other names: proARS1233

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr12:1013789-1014017
Within convergent intergenic space between YLR438W and YLR438C-A.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -163.6 ΔG° (kcal/mol) at location 1014009.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 27.8 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-1014 has unique ID: 445

Loading - Please wait...

ARS at XII-1014 has unique ID: 445

Studies that cloned this origin

Nieduszynski et al. (2006): Chr12:1013789-1014017


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr12:1012504-1013399

Xu et al. (2006): Chr12:1012750-1014400

Shor et al. (2009): Chr12:1012800-1014200 (orc2-1/wt peak ratio: 0.56)

Szilard et al. (2010): Chr12:1013715-1013725


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr12:1020700

Raghuraman et al. (2001): Chr12:1006700 (Trep: 27.8 min.) (Confidence: 9)

Alvino et al. (2007): Chr12:1008100 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr12:1013789-1014017 (Activity detected in: tof1, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-1014 has unique ID: 445

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTATGTTTTCTC                   
  Xu et al. (2006):      TTTATTTTACTTTTAGTATATTAAAAATGTGTAA  
  Xu et al. (2006):      TTTTTTATGTTTTCTCGTTTCTTTTCTTTTTTTT  
ACS LOGO:   ACS_logo  

ARS at XII-1014 has unique ID: 445

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeGACTCACTCAACTCCTCGTT
S. kudriavzeviiGACTCGCTCAACTCCTCGTT
S. mikataeGACTCGCTCAACTCCTCGTT
S. paradoxusGACTCACTCAACTCTTCGTT
S. bayanusGACTCGCTCAACTCCTCGTT
*************:*****

ARS at XII-1014 has unique ID: 445

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-1014 has unique ID: 445

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XII-1014 has unique ID: 445