Likely ARS at XI-463

No systematic name assigned

Other names: proARS1115

Status: Likely ARS: Identified by 5 genome-wide studies.

Genomic Location: Chr11:462033-463697
Probably within divergent intergenic space between YKR011C and YKR013W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -169.3 ΔG° (kcal/mol) at location 463173.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity not detected in HU.

ARS at XI-463 has unique ID: 383

Loading - Please wait...

ARS at XI-463 has unique ID: 383

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr11:462337-463380

Xu et al. (2006): Chr11:462035-463695

Shor et al. (2009): Chr11:462100-464500 (orc2-1/wt peak ratio: 0.39)

Szilard et al. (2010): Chr11:462665-462675

Müller et al. (2010): Chr11:462125-463400 (orc1-bah-delta/wt peak ratio: 0.56)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XI-463 has unique ID: 383

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      CAAAGGCTTTTAATGTTTAGGTAGTTACAGACCT  
  Eaton et al. (2010):      GCTTTTAATGTTTAGGTAGTTACAGACCTTTTG   
ACS LOGO:   ACS_logo  

ARS at XI-463 has unique ID: 383

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XI-463 has unique ID: 383

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XI-463 has unique ID: 383

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XI-463 has unique ID: 383