Confirmed ARS at X-654

ARS1020

Other names: proARS1020

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr10:654069-654309
Within tandem intergenic space between YJR124C and YJR125C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -143.0 ΔG° (kcal/mol) at location 654069.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 24.4 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-654 has unique ID: 353

Loading - Please wait...

ARS at X-654 has unique ID: 353

Studies that cloned this origin

Nieduszynski et al. (2006): Chr10:654069-654309


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:653927-654426

Xu et al. (2006): Chr10:653440-655430

Szilard et al. (2010): Chr10:654315-654325


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:655265 (Trep: 24.4 min.) (Confidence: 8)

Alvino et al. (2007): Chr10:653000 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:654000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr10:654069-654309 (Activity detected in: rev3 rad30, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-654 has unique ID: 353

Studies that confirmed an essential ACS element

  Xu et al. (2006):         ATTTACATTTT                      

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTATTTACATTTTGGT                   
ACS LOGO:   ACS_logo  

ARS at X-654 has unique ID: 353

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeAAGAAGGGCCCTTTTCAAATTTATTTACATTTTGGTCATTTGAAAATACTTTACTT
S. kudriavzeviiAAGGAAAATCTTTCACAAGATTATTTACATCTTGGTCAATTGCAAATATTTTATAC
S. mikataeGAAAGAAACGCATCCAAAGATTATTTACATTTTGGTCATTTACAAACATTTTAATT
S. paradoxusTAGAAGGGCGCATCTCCAGTTTATTTACATTTTGGTCATTCAAAACCATTTTAATT
S. bayanusTGAAAATGTTCACCATAAAAATATTAACATTTTGGTCGATTACTAATACTTTA-TG
:::::::*:****:****:******:*::*:*****::

ARS at X-654 has unique ID: 353

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-654 has unique ID: 353

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at X-654 has unique ID: 353